Model Details

Patient Information for Model: BCM-15115

Patient Information
Clinical Timeline

Color Keys:
 
 Positive
 
 Negative
 
 N/A

Clinical Information at Collection
Clinical Biomarkers/Mutations at Collection
Pathology Information at Collection

Model Information for Model: BCM-15115

Biomarkers & Mutations
Model Details
Mutations (Cancer Gene Census List)

The number of models in this collection with mutations in the listed gene
The number of models in this collection with mutations at the listed site
GeneChrStartEndRefAltVariant TypecDNA ChangeCodon ChangeProtein ChangeTVAF Gene Mutation Freq. Site Mutation Freq.Gene Mutation Freq.Site Mutation Freq.
ARX6676515866765158TTGCAGCAInsertionc.170_171insGCAGCAp.Q80_E81insQQ0.971425425
ARHGEF10818575561857556GAMissense Variantc.1949G>AaGc/aAcp.S650N0.403281281
ASXL1203102241331022413AGMissense Variantc.1898A>GcAt/cGtp.H633R0.358162162
ATIC2216211572216211572CTMissense Variantc.1411C>TCca/Tcap.P471S1.06363
BAP135244125552441255CCCACCGCGCCTGGCCCGGCCCACAFrame-shift Insertionc.514_515insTGTGGGCCGGGCCAGGCGCGGTGp.S172Mfs*221.06161
BCL11B149964125799641257GAMissense Variantc.1700C>TgCg/gTgp.A567V0.785151
CD274954630345463034AGMissense Variantc.253A>GAtc/Gtcp.I85V1.05151
CNBD188791734087917340GAMissense Variantc.190G>AGat/Aatp.D64N0.3639292
CREB3L1114632948946329489GAMissense Variantc.454G>AGcc/Accp.A152T1.0222222
CRLF2X13213491321349CTMissense Variantc.70G>AGtg/Atgp.V24M1.02222
CRTC1191887625818876258GAMissense Variantc.931G>AGtc/Atcp.V311I0.327575
CSF1R5149441113149441113GAMissense Variantc.1799C>TaCg/aTgp.T600M1.07171
CSMD38113668398113668398TCMissense Variantc.2677A>GAag/Gagp.K893E0.229281281
DAXX63328828533288285CTMissense Variantc.898G>AGtc/Atcp.V300I0.7713131
DDX5176249667062496670ACMissense Variantc.1438T>GTca/Gcap.S480A1.01111
CNV


Histology Information for Model: BCM-15115
There are no histology images for this model.













Metastasis Information for Model: BCM-15115
 
Patient
PDX
Abdomen
Anterosuperior mediastinum
Bone
Brain
CTC
Chest
Chest wall
Contralateral breast
Fallopian tubes
Hip
Kidney
Leg bone
Liver
Lung
Lymph Node
Mediastinum
Neck
Other
Ovary
Pancreas
Paratracheal adenopathy
Pericardium
Peritoneal cavity
Peritoneum
Pleura
Pleural Cavitiy
Pleural effusion
Posterior cervical nodes
SVC node
Skin
Thymus

Patient Treatment Information for Model: BCM-15115

Event IdTreatmentTreatment SettingAge at StartAge at EndDurationClinical ResponsePathologic ResponseReason Stopped
7AnastrazoleNeoadjuvant63.8864.17106 daysResidual DiseaseNot ReportedTreatment Completed
12PaclitaxelAdjuvant64.4264.5547 daysNot ReportedNot ApplicableTreatment Completed
13Radiation Therapy (RT)Adjuvant64.6164.6929 daysNot ReportedNot ApplicableTreatment Completed












Timeout
Your session is about to expire. Click 'Stay Connected' to continue the session.