Model Details

Patient Information for Model: BCM-15034

Patient Information
Clinical Timeline

Color Keys:
 
 Positive
 
 Negative
 
 N/A

Clinical Information at Collection
Clinical Biomarkers/Mutations at Collection
Pathology Information at Collection

Model Information for Model: BCM-15034

Biomarkers & Mutations
Model Details
Mutations (Cancer Gene Census List)

The number of models in this collection with mutations in the listed gene
The number of models in this collection with mutations at the listed site
GeneChrStartEndRefAltVariant TypecDNA ChangeCodon ChangeProtein ChangeTVAF Gene Mutation Freq. Site Mutation Freq.Gene Mutation Freq.Site Mutation Freq.
ARHGEF10L11791412217914122GAMissense Variantc.205G>AGac/Aacp.D69N0.88178178
ATR3142178144142178144CTMissense Variantc.7274G>AcGa/cAap.R2425Q0.91730163016
BARD12215595181215595181TTCATACTTTTCTTCCTGTTCAFrame-shift Insertionc.415_416insTGAACAGGAAGAAAAGTATGp.E139Vfs*680.612181181
BARD12215661788215661788CAMissense Variantc.212G>TtGt/tTtp.C71F0.332181181
BCR222365510523655105GCMissense Variantc.3222G>CgaG/gaCp.E1074D0.435131131
BRD4191535062515350625CTMissense Variantc.3290G>AcGt/cAtp.R1097H0.4488282
CDH1789516419695164196ATMissense Variantc.1696T>ATtt/Attp.F566I0.2464141
CIC194279630742796307CGMissense Variantc.2956C>GCtc/Gtcp.L986V0.477241241
CNTRL9123929920123929920GAMissense Variantc.4153G>AGaa/Aaap.E1385K0.2323323
CRLF2X13213491321349CTMissense Variantc.70G>AGtg/Atgp.V24M0.3532222
CYP2C8109679874996798749TCMissense Variantc.890A>GaAa/aGap.K297R0.45634163416
CYP2C8109682703096827030CTMissense Variantc.110G>AaGg/aAgp.R37K0.43834163416
EED118595628085956280GTMissense Variantc.9G>TgaG/gaTp.E3D0.3832121
EGFR75522925555229255GAMissense Variantc.761G>AaGg/aAgp.R254K0.48339253925
EIF4A23186503832186503832GCMissense Variantc.509G>CaGa/aCap.R170T0.7122121
CNV


Histology Information for Model: BCM-15034

Patient

PDX

ER

PR

HER2


Metastasis Information for Model: BCM-15034
 
Patient
PDX
Abdomen
Anterosuperior mediastinum
Bone
Brain
CTC
Chest
Chest wall
Contralateral breast
Fallopian tubes
Hip
Kidney
Leg bone
Liver
Lung
Lymph Node
Mediastinum
Neck
Other
Ovary
Pancreas
Paratracheal adenopathy
Pericardium
Peritoneal cavity
Peritoneum
Pleura
Pleural Cavitiy
Pleural effusion
Posterior cervical nodes
SVC node
Skin
Thymus

Patient Treatment Information for Model: BCM-15034

Event IdTreatmentTreatment SettingAge at StartAge at EndDurationClinical ResponsePathologic ResponseReason Stopped
12[Letrozole]Adjuvant62.9963.0418 daysNot ReportedNot ApplicableSide Effects
16[Anastrozole, Palbociclib]Recurrent/Metastatic63.0463.58197 daysNot ReportedDisease Progression
22[Paclitaxel]Recurrent/Metastatic63.6664.12168 daysNot ReportedDisease Progression
32[Everolimus, Exemestane]Recurrent/Metastatic64.1564.3366 daysNot ReportedDisease Progression
36[Capecitabine]Recurrent/Metastatic64.3364.4233 daysNot ReportedDisease Progression
42[Eribulin]Recurrent/Metastatic64.4364.5958 daysNot ReportedDisease Progression
52[Trastuzumab, Pertuzumab, Docetaxel]Recurrent/Metastatic64.6665.07150 daysCurrent Treatment
54[Pertuzumab,Trastuzumab]Recurrent/Metastatic63.0863.58183 daysNot ReportedDisease Progression












Timeout
Your session is about to expire. Click 'Stay Connected' to continue the session.