Model Details

Patient Information for Model: BCM-15006

Patient Information
Clinical Timeline

Color Keys:
 Positive
 Negative
 N/A

Clinical Information at Collection
Clinical Biomarkers/Mutations at Collection
Pathology Information at Collection

Model Information for Model: BCM-15006

Biomarkers & Mutations
Model Details
Mutations
The number of models in this collection with mutations in the listed gene
The number of models in this collection with mutations at the listed site
GeneChrStartEndRefAltVariant TypecDNA ChangeCodon ChangeProtein ChangeTVAFCOSMIC ID Gene Mutation Freq. Site Mutation Freq.
ABCB87150742308150742308GAMissense Variantc.1954G>Ac.(1954-1956)Gaa>Aaap.E652K0.20411
ABCB87150725634150725634GAMissense Variantc.32G>Ac.(31-33)cGg>cAgp.R11Q0.11411
ABCC9122199774921997749TAMissense Variantc.3197A>Tc.(3196-3198)aAa>aTap.K1066I0.11821
AC104809.32241870430241870430CTMissense Variantc.433C>Tc.(433-435)Cgg>Tggp.R145W0.50551
ACAN158940002389400023AGMissense Variantc.4207A>Gc.(4207-4209)Act>Gctp.T1403A0.9732015
ACVR12158622458158622461ATTCAIn-frame Deletionc.1038_1040delGAAc.(1036-1041)aagaat>aatp.K346del0.23121
ANLN73645991136459914ATCTAIn-frame Deletionc.2004_2006delTCTc.(2002-2007)gatctt>gatp.L670del0.22921
ARHGAP40203727242237272422GAMissense Variantc.1279G>Ac.(1279-1281)Gtg>Atgp.V427M0.38121
ARID1A12702334027023340GAMissense Variantc.446G>Ac.(445-447)gGc>gAcp.G149D0.958COSM534704191
ASIC54156787351156787354ATACAIn-frame Deletionc.25_27delGTAc.(25-27)gtadelp.V9del0.35611
ATP5S145079079950790803CACAGCFrame-shift Deletionc.499_502delACAGc.(499-504)acagacfsp.TD167fs0.85711
BIRC623274054432740547ATTCAIn-frame Deletionc.11057_11059delTTCc.(11056-11061)attctt>attp.L3687del0.15841
BTBD7149371218593712185AATGCTGCIn-frame Insertionc.2569_2569insGCAGCAc.(2569-2571)tct>GCAGCAtctp.856_857insAA1.011
C4orf4047102442571024485CCCTGTTGCAGCTGAGCCTGCTGCAGAGGCACCTGTTGGAGCTGAGCCTGCTGCAGAGGCACIn-frame Deletionc.457_516delCCTGTTGCAGCTGAGCCTGCTGCAGAGGCACCTGTTGGAGCTGAGCCTGCTGCAGAGGCAc.(457-516)cctgttgcagctgagcctgctgcagaggcacctgttggagctgagcctgctgcagaggcadelp.PVAAEPAAEAPVGAEPAAEA153del0.75822
C6orf5767127670671276706ACSplice Sitec.63A>Cc.(61-63)gcA>gcCp.A21A0.55411
CNV


Histology Information for Model: BCM-15006

Patient

PDX

H&E

ER

PR

HER2


Metastasis Information for Model: BCM-15006
 
Patient
PDX
Abdomen
Anterosuperior mediastinum
Bone
Brain
CTC
Chest
Chest wall
Contralateral breast
Fallopian tubes
Hip
Kidney
Leg bone
Liver
Lung
Lymph Node
Mediastinum
Neck
Other
Ovary
Pancreas
Paratracheal adenopathy
Pericardium
Peritoneal cavity
Peritoneum
Pleura
Pleural Cavitiy
Pleural effusion
Posterior cervical nodes
SVC node
Skin
Thymus

Patient Treatment Information for Model: BCM-15006

Event IdTreatmentTreatment SettingAge at StartAge at EndDurationClinical ResponsePathologic ResponseReason Stopped
114[Doxorubicin, Cyclophosphamide]Neoadjuvant33.9834.0940 daysPartial ResponseNot ReportedTreatment Completed
118[Paclitaxel, Carboplatin]Neoadjuvant34.1334.3477 daysNot ReportedNot ReportedTreatment Completed
121[Radiation Therapy (RT)]Neoadjuvant34.3934.540 daysComplete ResponseTreatment Completed
122[Cisplatin]Neoadjuvant34.434.4726 daysComplete ResponseTreatment Completed
140[Capecitabine]Adjuvant34.835.3183 daysNot ReportedTreatment Completed
330[Radiation Therapy (RT)]Recurrent/Metastatic35.80.0UnknownNot ReportedTreatment Completed
335[Capecitabine]Recurrent/Metastatic35.8335.9233 daysNot ReportedDisease Progression
345[Eribulin]Recurrent/Metastatic35.9535.964 days












Timeout
Your session is about to expire. Click 'Stay Connected' to continue the session.