Model Details

Patient Information for Model: BCM-0132

Patient Information
Clinical Timeline

Color Keys:
 
 Positive
 
 Negative
 
 N/A

Clinical Information at Collection
Clinical Biomarkers/Mutations at Collection
Pathology Information at Collection

Model Information for Model: BCM-0132

Biomarkers & Mutations
Model Details
Mutations (Cancer Gene Census List)

The number of models in this collection with mutations in the listed gene
The number of models in this collection with mutations at the listed site
GeneChrStartEndRefAltVariant TypecDNA ChangeCodon ChangeProtein ChangeTVAF Gene Mutation Freq. Site Mutation Freq.Gene Mutation Freq.Site Mutation Freq.
A1CF105256661152566611CTMissense Variantc.1639G>AGtg/Atgp.V547M1.07575
AFF45132232775132232795GTGTAGCTATTCCCAGTGCCCGFrame-shift Deletionc.1527_1546delp.Q509Hfs*10.5338181
ARX6676515866765158TTGCAGCAGCAGCAInsertionc.170_171insGCAGCAGCAGCAp.Q80_E81insQQQQ1.0422422
ARID1A12702325227023252CTMissense Variantc.358C>TCcg/Tcgp.P120S0.971222222
ARID1B6157527664157527668CTGTTCFrame-shift Deletionc.5351_5354delp.F1785Lfs*511.0371371
BIRC623275483832754838CTMissense Variantc.12041C>TaCa/aTap.T4014I1.0201201
BRCA2133291471232914712CAMissense Variantc.6220C>ACac/Aacp.H2074N1.0281281
CLTCL1221920747919207479CTMissense Variantc.2834G>AcGc/cAcp.R945H0.417372372
CPEB3109399995693999956CTMissense Variantc.152G>AaGc/aAcp.S51N0.9765252
CREB3L1114633901146339011GAMissense Variantc.1231G>AGca/Acap.A411T0.355228228
ELF31201981774201981774GAMissense Variantc.485G>AgGc/gAcp.G162D0.43610101010
ELK41205589237205589237CTMissense Variantc.937G>AGta/Atap.V313I0.4783131
EPHA338925937489259374CGMissense Variantc.518C>GcCt/cGtp.P173R0.5415151
ESR16152129456152129456AGMissense Variantc.409A>GAgc/Ggcp.S137G1.09393
FAM131B7143053723143053723CTMissense Variantc.721G>AGct/Actp.A241T0.99231283128
CNV


Histology Information for Model: BCM-0132

Patient

PDX

ER

PR

HER2


Metastasis Information for Model: BCM-0132
 
Patient
PDX
Abdomen
Anterosuperior mediastinum
Bone
Brain
CTC
Chest
Chest wall
Contralateral breast
Fallopian tubes
Hip
Kidney
Leg bone
Liver
Lung
Lymph Node
Mediastinum
Neck
Other
Ovary
Pancreas
Paratracheal adenopathy
Pericardium
Peritoneal cavity
Peritoneum
Pleura
Pleural Cavitiy
Pleural effusion
Posterior cervical nodes
SVC node
Skin
Thymus

Patient Treatment Information for Model: BCM-0132

Event IdTreatmentTreatment SettingAge at StartAge at EndDurationClinical ResponsePathologic Response
21[Doxorubicin, Cyclophosphamide]Neoadjuvant58.9659.0740 daysPartial Response
25[Paclitaxel, Carboplatin]Neoadjuvant59.1359.3891 daysResidual Disease
31[Docetaxel]Adjuvant59.4959.5833 days
33[Radiation Therapy (RT)]Adjuvant59.7559.8329 days
35[Capecitabine]Adjuvant59.9560.36150 daysStable Disease












Timeout
Your session is about to expire. Click 'Stay Connected' to continue the session.