Model Details

Patient Information for Model: BCM-0132

Patient Information
Clinical Timeline

Color Keys:
 Positive
 Negative
 N/A

Clinical Information at Collection
Clinical Biomarkers/Mutations at Collection
Pathology Information at Collection

Model Information for Model: BCM-0132

Biomarkers & Mutations
Model Details
Mutations
The number of models in this collection with mutations in the listed gene
The number of models in this collection with mutations at the listed site
GeneChrStartEndRefAltVariant TypecDNA ChangeCodon ChangeProtein ChangeTVAFCOSMIC ID Gene Mutation Freq. Site Mutation Freq.
ACAN158940002389400023AGMissense Variantc.4207A>Gc.(4207-4209)Act>Gctp.T1403A0.8962015
ACRCX7082369270823716CCCGACGACAACAGTGATGATTCATCIn-frame Deletionc.566_589delCCGACGACAACAGTGATGATTCATc.(565-591)cccgacgacaacagtgatgattcatcc>cccp.DDNSDDSS198del1.021
ACTR835391010953910109TTGInsertion at Splice Sitec.e7-20.544
AFF45132232775132232795GTGTAGCTATTCCCAGTGCCCGFrame-shift Deletionc.1527_1546delGGGCACTGGGAATAGCTACAc.(1525-1548)cagggcactgggaatagctacactfsp.QGTGNSYT509fs0.53321
AMPD11115218564115218564GGAFrame-shift Insertionc.1536_1536insTc.(1534-1536)ttcfsp.F512fs1.031
ANGEL1147725702077257020CAMissense Variantc.1786G>Tc.(1786-1788)Ggt>Tgtp.G596C1.011
ANKS1A63485730234857302GGGGCGGCIn-frame Insertionc.123_123insGGCGGCc.(124-126)ggc>ggGGCGGCcp.42_43insAA1.074
ARAP1117243767772437677CCGFrame-shift Insertionc.497_497insCc.(496-498)cgcfsp.R166fs1.031
ARID1B6157527664157527668CTGTTCFrame-shift Deletionc.5390_5393delTGTTc.(5389-5394)ctgtttfsp.LF1797fs1.0101
ARVCF221995946519959465GAMissense Variantc.2725C>Tc.(2725-2727)Cgg>Tggp.R909W0.435COSM72558921
ARXX2503177625031779TGCCTIn-frame Deletionc.333_335delGGCc.(331-336)gcggca>gcap.111_112AA>A1.021
ATXN3149253736492537364CCTGCTGCTGCTGCTGTIn-frame Insertionc.906_906insACAGCAGCAGCAGCAc.(904-906)cag>caACAGCAGCAGCAGCAgp.302_302Q>QQQQQQ1.061
B3GNT412122691060122691060TGMissense Variantc.187T>Gc.(187-189)Tcc>Gccp.S63A1.021
BACE111117186370117186370CTMissense Variantc.142G>Ac.(142-144)Gac>Aacp.D48N1.011
BCHE3165548207165548207CAMissense Variantc.615G>Tc.(613-615)tgG>tgTp.W205C0.297COSM411500931
CNV


Histology Information for Model: BCM-0132

Patient

PDX

ER

PR

HER2


Metastasis Information for Model: BCM-0132
 
Patient
PDX
Abdomen
Anterosuperior mediastinum
Bone
Brain
CTC
Chest
Chest wall
Contralateral breast
Fallopian tubes
Hip
Kidney
Leg bone
Liver
Lung
Lymph Node
Mediastinum
Neck
Other
Ovary
Pancreas
Paratracheal adenopathy
Pericardium
Peritoneal cavity
Peritoneum
Pleura
Pleural Cavitiy
Pleural effusion
Posterior cervical nodes
SVC node
Skin
Thymus

Patient Treatment Information for Model: BCM-0132

Event IdTreatmentTreatment SettingAge at StartAge at EndDurationClinical ResponsePathologic Response
21[Doxorubicin, Cyclophosphamide]Neoadjuvant58.9659.0740 daysPartial Response
25[Paclitaxel, Carboplatin]Neoadjuvant59.1359.3891 daysResidual Disease
31[Docetaxel]Adjuvant59.4959.5833 days
33[Radiation Therapy (RT)]Adjuvant59.7559.8329 days
35[Capecitabine]Adjuvant59.9560.36150 daysStable Disease












Timeout
Your session is about to expire. Click 'Stay Connected' to continue the session.