Model Details

Patient Information for Model: BCM-0132

Patient Information
Clinical Timeline

Color Keys:
 
 Positive
 
 Negative
 
 N/A

Clinical Information at Collection
Clinical Biomarkers/Mutations at Collection
Pathology Information at Collection

Model Information for Model: BCM-0132

Biomarkers & Mutations
Model Details
Mutations (Cancer Gene Census List)

The number of models in this collection with mutations in the listed gene
The number of models in this collection with mutations at the listed site
GeneChrStartEndRefAltcDNA ChangeCodon ChangeProtein ChangeTVAF Gene Mutation Freq. Site Mutation Freq.Most Severe EffectAll EffectsMutation ImpactTranscript IDClinVar Clinical SignificanceCOSMIC IDgnomAD Non-Cancer AFdbSNP IDGene Mutation Freq.Site Mutation Freq.Transcript IDClinVar Clinical SignificanceCOSMIC IDdbSNP ID
ABI1chr102674228526742285AG0.9994034Downstream Gene Variantdownstream_gene_variantMODIFIERNM_005470.3


rs10764638
4034NM_005470.3rs10764638
ABL2chr1179097764179097764AG0.337103Downstream Gene Variantdownstream_gene_variantMODIFIERNM_007314.3


rs10159048
103NM_007314.3rs10159048
AFDNchr6167826335167826335CT0.886201Upstream Gene Variantupstream_gene_variantMODIFIERNM_001291964.1


0.000021309800rs368865162
201NM_001291964.1rs368865162
AFF1chr48713577387135773AG0.99880803' UTR variant3_prime_UTR_variantMODIFIERNM_001166693.2


rs342464
8080NM_001166693.2rs342464
AFF4chr5132897083132897083GTGTAGCTATTCCCAGTGCCCGc.1527_1546delGGGCACTGGGAATAGCTACAp.Gln509fs0.523211Frameshift Mutationframeshift_variantHIGHNM_014423.3



211NM_014423.3
AKAP9chr79194097691940976GC0.97868645' UTR variant5_prime_UTR_variantMODIFIERNM_005751.4


rs4727267
6864NM_005751.4rs4727267
AKT3chr1243499640243499641GGT0.526157Downstream Gene Variantdownstream_gene_variantMODIFIERNM_005465.4


rs5782265
157NM_005465.4rs5782265
AKT3chr1243499640243499641GGT0.526157Intragenic Variantintragenic_variantMODIFIER


rs5782265
157rs5782265
APOBEC3Bchr223898223838982244AACCAGAG0.457261Upstream Gene Variantupstream_gene_variantMODIFIERNM_004900.4


rs200275128
261NM_004900.4rs200275128
APOBEC3Bchr223898231838982318GA0.465261Upstream Gene Variantupstream_gene_variantMODIFIERNM_004900.4


rs78871147
261NM_004900.4rs78871147
ARchrX6754651467546514TGGCTc.1418_1420delGCGp.Gly473del0.858452In-frame Deletion (Disruptive)disruptive_inframe_deletionMODERATENM_000044.3



452NM_000044.3
ARID1Achr12669676126696761CTc.358C>TCcg/Tcgp.Pro120Ser0.952182Missense Variantmissense_variantMODERATENM_006015.4

COSM4988534
0.000271628000rs571264557
182NM_006015.4COSM4988534rs571264557
ARID1Bchr6157206530157206530CTGTTCc.5394_5397delTGTTp.Phe1798fs0.937161Frameshift Mutationframeshift_variantHIGHNM_020732.3



161NM_020732.3
ASXL1chr203243742832437428TC0.449433' UTR variant3_prime_UTR_variantMODIFIERNM_015338.5


rs2295763
4943NM_015338.5rs2295763
ATICchr2215311925215311925AG0.9827974Upstream Gene Variantupstream_gene_variantMODIFIERNM_004044.6


rs78631308
7974NM_004044.6rs78631308
CNV


Histology Information for Model: BCM-0132

Patient

PDX

ER

PR

HER2


Metastasis Information for Model: BCM-0132
 
Patient
PDX
Abdomen
Anterosuperior mediastinum
Bone
Brain
CTC
Chest
Chest wall
Contralateral breast
Fallopian tubes
Hip
Kidney
Leg bone
Liver
Lung
Lymph Node
Mediastinum
Neck
Other
Ovary
Pancreas
Paratracheal adenopathy
Pericardium
Peritoneal cavity
Peritoneum
Pleura
Pleural Cavitiy
Pleural effusion
Posterior cervical nodes
SVC node
Skin
Thymus

Patient Treatment Information for Model: BCM-0132

Event IdTreatmentTreatment SettingAge at StartAge at EndDurationClinical ResponsePathologic Response
21[Doxorubicin, Cyclophosphamide]Neoadjuvant58.9659.0740 daysPartial Response
25[Paclitaxel, Carboplatin]Neoadjuvant59.1359.3891 daysResidual Disease
31[Docetaxel]Adjuvant59.4959.5833 days
33[Radiation Therapy (RT)]Adjuvant59.7559.8329 days
35[Capecitabine]Adjuvant59.9560.36150 daysStable Disease












Timeout
Your session is about to expire. Click 'Stay Connected' to continue the session.