Model Details

Patient Information for Model: BCM-0132

Patient Information
Clinical Timeline

Color Keys:

Clinical Information at Collection
Clinical Biomarkers/Mutations at Collection
Pathology Information at Collection

Model Information for Model: BCM-0132

Biomarkers & Mutations
Model Details
Mutations (Cancer Gene Census List)

The number of models in this collection with mutations in the listed gene
The number of models in this collection with mutations at the listed site
GeneChrStartEndRefAltcDNA ChangeCodon ChangeProtein ChangeTVAF Gene Mutation Freq. Site Mutation Freq.Most Severe EffectAll EffectsMutation ImpactTranscript IDClinVar Clinical SignificanceCOSMIC IDgnomAD Non-Cancer AFdbSNP IDGene Mutation Freq.Site Mutation Freq.Transcript IDClinVar Clinical SignificanceCOSMIC IDdbSNP ID
ABI1chr102674228526742285AG0.9994034Downstream Gene Variantdownstream_gene_variantMODIFIERNM_005470.3

ABL2chr1179097764179097764AG0.337103Downstream Gene Variantdownstream_gene_variantMODIFIERNM_007314.3

AFDNchr6167826335167826335CT0.886201Upstream Gene Variantupstream_gene_variantMODIFIERNM_001291964.1

AFF1chr48713577387135773AG0.99880803' UTR variant3_prime_UTR_variantMODIFIERNM_001166693.2

AFF4chr5132897083132897083GTGTAGCTATTCCCAGTGCCCGc.1527_1546delGGGCACTGGGAATAGCTACAp.Gln509fs0.523211Frameshift Mutationframeshift_variantHIGHNM_014423.3

AKAP9chr79194097691940976GC0.97868645' UTR variant5_prime_UTR_variantMODIFIERNM_005751.4

AKT3chr1243499640243499641GGT0.526157Downstream Gene Variantdownstream_gene_variantMODIFIERNM_005465.4

AKT3chr1243499640243499641GGT0.526157Intragenic Variantintragenic_variantMODIFIER

APOBEC3Bchr223898223838982244AACCAGAG0.457261Upstream Gene Variantupstream_gene_variantMODIFIERNM_004900.4

APOBEC3Bchr223898231838982318GA0.465261Upstream Gene Variantupstream_gene_variantMODIFIERNM_004900.4

ARchrX6754651467546514TGGCTc.1418_1420delGCGp.Gly473del0.858452In-frame Deletion (Disruptive)disruptive_inframe_deletionMODERATENM_000044.3

ARID1Achr12669676126696761CTc.358C>TCcg/Tcgp.Pro120Ser0.952182Missense Variantmissense_variantMODERATENM_006015.4

ARID1Bchr6157206530157206530CTGTTCc.5394_5397delTGTTp.Phe1798fs0.937161Frameshift Mutationframeshift_variantHIGHNM_020732.3

ASXL1chr203243742832437428TC0.449433' UTR variant3_prime_UTR_variantMODIFIERNM_015338.5

ATICchr2215311925215311925AG0.9827974Upstream Gene Variantupstream_gene_variantMODIFIERNM_004044.6


Histology Information for Model: BCM-0132






Metastasis Information for Model: BCM-0132
Anterosuperior mediastinum
Chest wall
Contralateral Breast
Fallopian tubes
Leg bone
Lymph Node
Paratracheal adenopathy
Peritoneal cavity
Pleural Cavitiy
Pleural effusion
Posterior cervical nodes
SVC node

Patient Treatment Information for Model: BCM-0132

Event IdTreatmentTreatment SettingAge at StartAge at EndDurationClinical ResponsePathologic ResponseReason Stopped
15Doxorubicin, CyclophosphamideNeoadjuvant58.9659.0740 daysPartial ResponseNot ApplicableTreatment Completed
20Paclitaxel, CarboplatinNeoadjuvant59.1359.3891 daysComplete ResponsePartial ResponseTreatment Completed
30DocetaxelAdjuvant59.4959.5833 days
35Radiation Therapy (RT)Adjuvant59.7559.8329 days
40CapecitabineAdjuvant59.9560.36150 daysStable Disease

Your session is about to expire. Click 'Stay Connected' to continue the session.