Model Details

Patient Information for Model: BCM-0113

Patient Information
Clinical Timeline

Color Keys:
 Positive
 Negative
 N/A

Clinical Information at Collection
Clinical Biomarkers/Mutations at Collection
Pathology Information at Collection

Model Information for Model: BCM-0113

Biomarkers & Mutations
Model Details
Mutations
The number of models in this collection with mutations in the listed gene
The number of models in this collection with mutations at the listed site
GeneChrStartEndRefAltVariant TypecDNA ChangeCodon ChangeProtein ChangeTVAFCOSMIC ID Gene Mutation Freq. Site Mutation Freq.
ACSF3168921244889212448AGMissense Variantc.809A>Gc.(808-810)gAg>gGgp.E270G0.26943
ADAMTS20124383373543833739TATTATFrame-shift Deletionc.2424_2427delTAATc.(2422-2427)attaatfsp.IN808fs0.411
ADK107634905676349056CGMissense Variantc.743C>Gc.(742-744)gCt>gGtp.A248G0.66721
AFF32100210334100210335CGCFrame-shift Deletionc.1788delCc.(1786-1788)gccfsp.A596fs0.40752
AGPS2178372699178372699AGSplice Sitec.1547A>Gc.(1546-1548)gAc>gGcp.D516G0.5631
AKAP979173502391735023GCMissense Variantc.11362G>Cc.(11362-11364)Gtc>Ctcp.V3788L0.44461
AL627309.11139000139000GCMissense Variantc.310C>Gc.(310-312)Cta>Gtap.L104V0.31711
ALPL12190409721904097CCTFrame-shift Insertionc.1531_1531insTc.(1531-1533)ctgfsp.L511fs0.49411
ANK184155280941552809GAMissense Variantc.3001C>Tc.(3001-3003)Cgt>Tgtp.R1001C0.20721
ANK24114282012114282012GCMissense Variantc.10616G>Cc.(10615-10617)aGg>aCgp.R3539T0.3141
ANTXRL104768278347682783CGMissense Variantc.1211C>Gc.(1210-1212)cCg>cGgp.P404R0.20921
ANXA104169102846169102846GAMissense Variantc.737G>Ac.(736-738)cGa>cAap.R246Q0.56511
APOA411116692373116692373CTMissense Variantc.401G>Ac.(400-402)cGc>cAcp.R134H0.65541
ARX6676515866765158TGCATGCAGCAGCAGCAGCAGCAIn-frame Insertionc.170_170insGCAGCAc.(169-171)ctg>cGCAGCAtgp.57_57L>RSM1.02928
ATHL111294436294436GCMissense Variantc.1234G>Cc.(1234-1236)Gct>Cctp.A412P0.52111
CNV


Histology Information for Model: BCM-0113

Patient

PDX

H&E

ER

PR

HER2


Metastasis Information for Model: BCM-0113
 
Patient
PDX
Abdomen
Anterosuperior mediastinum
Bone
Brain
CTC
Chest
Chest wall
Contralateral breast
Fallopian tubes
Hip
Kidney
Leg bone
Liver
Lung
Lymph Node
Mediastinum
Neck
Other
Ovary
Pancreas
Paratracheal adenopathy
Pericardium
Peritoneal cavity
Peritoneum
Pleura
Pleural Cavitiy
Pleural effusion
Posterior cervical nodes
SVC node
Skin
Thymus

Patient Treatment Information for Model: BCM-0113

Event IdTreatmentTreatment SettingAge at StartAge at EndDurationClinical ResponsePathologic ResponseReason Stopped
107[Doxorubicin]Neoadjuvant63.5163.5826 daysNot ReportedNot ReportedUnknown
112[Doxorubicin, Cyclophosphamide]Neoadjuvant63.6663.8362 daysNot ReportedNot ReportedTreatment Completed
116[Docetaxel]Neoadjuvant63.8963.89UnknownNot ReportedNot ReportedSide Effects
117[Paclitaxel]Neoadjuvant63.9564.0329 daysNot ReportedNot ReportedSide Effects
290[Carboplatin]Adjuvant64.2164.3862 daysNot ReportedNot ReportedTreatment Completed
315[Ixabepilone, Capecitabine]Adjuvant64.5364.7373 daysNot ReportedNot ReportedUnknown












Timeout
Your session is about to expire. Click 'Stay Connected' to continue the session.