Model Details

Patient Information for Model: BCM-0104

Patient Information
Clinical Timeline

Color Keys:
 Positive
 Negative
 N/A

Clinical Information at Collection
Clinical Biomarkers/Mutations at Collection
Pathology Information at Collection

Model Information for Model: BCM-0104

Biomarkers & Mutations
Model Details
Mutations
The number of models in this collection with mutations in the listed gene
The number of models in this collection with mutations at the listed site
GeneChrStartEndRefAltVariant TypecDNA ChangeCodon ChangeProtein ChangeTVAFCOSMIC ID Gene Mutation Freq. Site Mutation Freq.
AC091801.1731886833188683CTMissense Variantc.112G>Ac.(112-114)Gcc>Accp.A38T0.44411
AC136604.15179078817179078940CCAGGCATCAGAGCCTCTGTGTCCCCTGAAGCACCCTTCACACCGGCCACCTGCGAGCACCCTATCACCAAACCTGACCAGCTCCACAGAATCCTTGGGGTATCTGTCATCCCTCAGCTCCTCTCIn-frame Deletionc.301_423delCAGGCATCAGAGCCTCTGTGTCCCCTGAAGCACCCTTCACACCGGCCACCTGCGAGCACCCTATCACCAAACCTGACCAGCTCCACAGAATCCTTGGGGTATCTGTCATCCCTCAGCTCCTCTc.(301-423)caggcatcagagcctctgtgtcccctgaagcacccttcacaccggccacctgcgagcaccctatcaccaaacctgaccagctccacagaatccttggggtatctgtcatccctcagctcctctdelp.QASEPLCPLKHPSHRPPASTLSPNLTSSTESLGYLSSLSSS101del0.3411
AC136604.15179078992179078992GGGGCIn-frame Insertionc.475_475insGGCc.(475-477)ggg>GGCgggp.159_159G>GG0.44611
ACAN158940002389400023AGMissense Variantc.4207A>Gc.(4207-4209)Act>Gctp.T1403A0.9562015
ACE176156642261566422GAMissense Variantc.848G>Ac.(847-849)cGc>cAcp.R283H0.99441
ADAMTS14107251185172511851GCSplice Sitec.2606G>Cc.(2605-2607)gGg>gCgp.G869A0.60821
ADARB1214660032046600320GAMissense Variantc.1039G>Ac.(1039-1041)Gct>Actp.A347T0.30621
AFF32100623675100623675CTMissense Variantc.422G>Ac.(421-423)aGt>aAtp.S141N0.6951
ANK3106183268561832685GAMissense Variantc.7954C>Tc.(7954-7956)Cat>Tatp.H2652Y0.7471
APTX93297447332974473TCMissense Variantc.899A>Gc.(898-900)tAc>tGcp.Y300C0.50821
ARHGAP265142593647142593647GAMissense Variantc.2350G>Ac.(2350-2352)Gat>Aatp.D784N1.021
ATXN161632791516327915ATGCATGCTGCIn-frame Insertionc.627_627insGCAGCAc.(625-627)cat>caGCAGCAtp.208_209insQQ0.6053632
C1QTNF81611449101144910CTMissense Variantc.13G>Ac.(13-15)Gcc>Accp.A5T1.011
CAC1S1201009194201009194CTMissense Variantc.5387G>Ac.(5386-5388)gGc>gAcp.G1796D0.82771
CACYBP1174977840174977844AGAGTADeletion at Splice Sitec.400_401delGAGTc.(400-402)gag>gp.E134fs0.47511
CNV


Histology Information for Model: BCM-0104

Patient

PDX

H&E

ER

PR

HER2


Metastasis Information for Model: BCM-0104
 
Patient
PDX
Abdomen
Anterosuperior mediastinum
Bone
Brain
CTC
Chest
Chest wall
Contralateral breast
Fallopian tubes
Hip
Kidney
Leg bone
Liver
Lung
Lymph Node
Mediastinum
Neck
Other
Ovary
Pancreas
Paratracheal adenopathy
Pericardium
Peritoneal cavity
Peritoneum
Pleura
Pleural Cavitiy
Pleural effusion
Posterior cervical nodes
SVC node
Skin
Thymus

Patient Treatment Information for Model: BCM-0104

Event IdTreatmentTreatment SettingAge at StartAge at EndDurationClinical ResponsePathologic Response
13[Paclitaxel]Neoadjuvant58.358.76168 daysPartial ResponseNot Reported
23[Radiation Therapy (RT)]Adjuvant59.3359.4647 daysNot ReportedNot Applicable
33[Radiation Therapy (RT)]Recurrent/Metastatic59.8159.8411 daysNot ReportedNot Applicable












Timeout
Your session is about to expire. Click 'Stay Connected' to continue the session.