Model Details

Patient Information for Model: BCM-0046

Patient Information
Clinical Timeline

Color Keys:
 Positive
 Negative
 N/A

Clinical Information at Collection
Clinical Biomarkers/Mutations at Collection
Pathology Information at Collection

Model Information for Model: BCM-0046

Biomarkers & Mutations
Model Details
Mutations
The number of models in this collection with mutations in the listed gene
The number of models in this collection with mutations at the listed site
GeneChrStartEndRefAltVariant TypecDNA ChangeCodon ChangeProtein ChangeTVAFCOSMIC ID Gene Mutation Freq. Site Mutation Freq.
ABHD4142307542623075426GAMissense Variantc.739G>Ac.(739-741)Gca>Acap.A247T0.41211
AC104809.32241874927241874947GCAGCGGCAGGAGCAGCTGGAGFrame-shift Deletionc.1774_1793delCAGCGGCAGGAGCAGCTGGAc.(1774-1794)cagcggcaggagcagctggagfsp.QRQEQLE592fs1.051
ACAN158939996689399966GAMissense Variantc.4150G>Ac.(4150-4152)Gct>Actp.A1384T0.81204
ADAM294175899001175899001TTCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGACGCCTTCCIn-frame Insertionc.2325_2325insCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGACGCCTTCCc.(2326-2328)cag>caCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGACGCCTTCCgp.776_776Q>HRVNLL*CLPRVILS*RLP0.96154
ADORA2B171587799115877992AGADeletion at Splice Sitec.e2-11.011
AGAP6105176927151769271CGMissense Variantc.1386C>Gc.(1384-1386)agC>agGp.S462R0.38921
AHK116229945462299454TCMissense Variantc.2435A>Gc.(2434-2436)aAc>aGcp.N812S0.24781
AKAP13158612342586123425GAMissense Variantc.2126G>Ac.(2125-2127)tGt>tAtp.C709Y0.64241
AKAP6143329205133292051TCMissense Variantc.5032T>Cc.(5032-5034)Tct>Cctp.S1678P0.25311
ALDH212112227649112227649ATNonsense Mutationc.463A>Tc.(463-465)Aag>Tagp.K155*0.77311
ANKRD27193311899733118997GAMissense Variantc.1412C>Tc.(1411-1413)gCt>gTtp.A471V0.23511
ANKRD30B181475295114752951GTMissense Variantc.450G>Tc.(448-450)gaG>gaTp.E150D0.435COSM98680511
ASPHD2222682974926829749CCGACACCACCGCTIn-frame Insertionc.168_168insGACACCACCGCTc.(169-171)gac>gaGACACCACCGCTcp.57_57D>ETPPL0.71911
BAIAP2L2223850428338504283TCMissense Variantc.193A>Gc.(193-195)Agc>Ggcp.S65G0.75381
BAP135243851852438518ACMissense Variantc.1201T>Gc.(1201-1203)Tat>Gatp.Y401D1.021
CNV


Histology Information for Model: BCM-0046

Patient

PDX

H&E

ER

PR

HER2


Metastasis Information for Model: BCM-0046
 
Patient
PDX
Abdomen
Anterosuperior mediastinum
Bone
Brain
CTC
Chest
Chest wall
Contralateral breast
Fallopian tubes
Hip
Kidney
Leg bone
Liver
Lung
Lymph Node
Mediastinum
Neck
Other
Ovary
Pancreas
Paratracheal adenopathy
Pericardium
Peritoneal cavity
Peritoneum
Pleura
Pleural Cavitiy
Pleural effusion
Posterior cervical nodes
SVC node
Skin
Thymus

Patient Treatment Information for Model: BCM-0046

Event IdTreatmentTreatment SettingAge at StartAge at EndDurationClinical ResponsePathologic Response
8[Epirubicin, Cyclophosphamide]Neoadjuvant53.6253.8480 daysPartial ResponseNot Reported
12[Docetaxel]Neoadjuvant53.8554.0262 daysNot ReportedNot Reported
22[Radiation Therapy (RT)]Adjuvant54.2454.4162 daysNot ReportedNot Reported












Timeout
Your session is about to expire. Click 'Stay Connected' to continue the session.