PDX Portal

Model Details

Patient Information for Model: BCM-0002

Model Contact

Model: BCM-0002
Model Contact: Michael Lewis
Institution: BCM Breast PDX Program
Email: mtlewis@bcm.edu

Patient Information

Clinical Timeline

Color Keys:

Positive

Negative

N/A

Clinical Information at Collection

Clinical Biomarkers/Mutations at Collection

Pathology Information at Collection

Model Information for Model: BCM-0002

Model Details - Initial Implantation of Patient Tissue

Biomarkers & Mutations

Model Details - Acceptable Conditions for Passaging

Mutations (Cancer Gene Census List)

GeneFilter by Gene	ChrFilter by Chr	Start	End	Ref	Alt	cDNA Change	Codon Change	Protein Change	TVAF	Gene Mutation Freq.	Site Mutation Freq.	Most Severe Effect	All Effects	Mutation Impact	Transcript ID	ClinVar Clinical Significance	COSMIC ID	gnomAD Non-Cancer AF	dbSNP ID	Gene Mutation Freq.	Site Mutation Freq.	Transcript ID	ClinVar Clinical Significance	COSMIC ID	dbSNP ID
AFF1	chr4	87115243	87115243	C	A	c.2410C>A	Cac/Aac	p.H804N	0.044	12	1	Missense Variant	Missense Variant	MODERATE	ENST00000395146.8				.	12	1	ENST00000395146.8			.
AKAP9	chr7	92001306	92001306	G	T	c.1389G>T	atG/atT	p.M463I	0.386	115	73	Missense Variant	Missense Variant	MODERATE	ENST00000356239.8	Benign	COSV62345589	0.376835000000	rs6964587	115	73	ENST00000356239.8	Benign	COSV62345589	rs6964587
AKAP9	chr7	92085597	92085597	C	T	c.8935C>T	Cct/Tct	p.P2979S	0.992	115	115	Missense Variant	Missense Variant	MODERATE	ENST00000356239.8	Benign/Likely_benign	COSV104663065	0.996325000000	rs1063242	115	115	ENST00000356239.8	Benign/Likely_benign	COSV104663065	rs1063242
AKAP9	chr7	92077721	92077721	C	T	c.6791C>T	gCc/gTc	p.A2264V	0.116	115	1	Missense Variant	Missense Variant	MODERATE	ENST00000356239.8				.	115	1	ENST00000356239.8			.
AKAP9	chr7	92022864	92022864	A	AAAC	c.4004_4006dup	aaa/aAACaa	p.K1335_L1336insQ	0.358	115	73	In-frame Insertion	In-frame Insertion	MODERATE	ENST00000356239.8		COSV62337888		rs10644111	115	73	ENST00000356239.8		COSV62337888	rs10644111
ALK	chr2	29193781	29193784	GCTC	G	c.4303_4305del	GAG/-	p.E1435del	0.325	115	2	In-frame Deletion	In-frame Deletion	MODERATE	ENST00000389048.8				rs138827116	115	2	ENST00000389048.8			rs138827116
ALK	chr2	29193706	29193706	T	C	c.4381A>G	Atc/Gtc	p.I1461V	0.995	115	115	Missense Variant	Missense Variant	MODERATE	ENST00000389048.8	Benign	COSV101201052	0.997594000000	rs1670283	115	115	ENST00000389048.8	Benign	COSV101201052	rs1670283
ALK	chr2	29193500	29193500	G	C	c.4587C>G	gaC/gaG	p.D1529E	0.321	115	80	Missense Variant	Missense Variant	MODERATE	ENST00000389048.8	Benign	COSV66569695	0.472160000000	rs1881421	115	80	ENST00000389048.8	Benign	COSV66569695	rs1881421
AMER1	chrX	64192810	64192810	A	C	c.477T>G	ttT/ttG	p.F159L	0.956	23	16	Missense Variant	Missense Variant	MODERATE	ENST00000374869.8	Benign	COSV57654201	0.041796500000	rs34677493	23	16	ENST00000374869.8	Benign	COSV57654201	rs34677493
APC	chr5	112707798	112707840	CGGCGGCAGCAGGAGCTGCGTCCGGCAGGAGACGAAGAGCCCG	C	c.88_129del	GGCGGCAGCAGGAGCTGCGTCCGGCAGGAGACGAAGAGCCCG/-	p.S30_G43del	0.352	100	1	In-frame Deletion	In-frame Deletion	MODERATE	ENST00000507379.5				.	100	1	ENST00000507379.5			.
APC	chr5	112841059	112841059	T	A	c.5465T>A	gTc/gAc	p.V1822D	0.979	100	100	Missense Variant	Missense Variant	MODERATE	ENST00000257430.9	Benign	COSV57321643	0.794920000000	rs459552	100	100	ENST00000257430.9	Benign	COSV57321643	rs459552
AR	chrX	67545316	67545331	TGCAGCAGCAGCAGCA	T	c.225_239del	ctGCAGCAGCAGCAGCAg/ctg	p.Q76_Q80del	0.966	101	16	In-frame Deletion	In-frame Deletion	MODERATE	ENST00000374690.9		COSV104424802		.	101	16	ENST00000374690.9		COSV104424802	.
ARID1A	chr1	26775697	26775697	A	G	c.5114A>G	aAc/aGc	p.N1705S	0.34	48	4	Missense Variant	Missense Variant	MODERATE	ENST00000324856.13	Benign	COSV104411707	0.006846420000	rs61756316	48	4	ENST00000324856.13	Benign	COSV104411707	rs61756316
ARID1B	chr6	156778268	156778268	C	CCAG	c.609_611dup	-/CAG	p.Q214dup	0.978	80	4	In-frame Insertion	In-frame Insertion	MODERATE	ENST00000636930.2		COSV51651299		.	80	4	ENST00000636930.2		COSV51651299	.
ATR	chr3	142558717	142558717	A	G	c.1792T>C	Tgg/Cgg	p.W598R	0.188	101	1	Missense Variant	Missense Variant	MODERATE	ENST00000350721.9				.	101	1	ENST00000350721.9			.

CNV

PDX Validation

In order to validate the identity of Baylor College of Medicine patient-derived xenograft (PDX) models, short tandem repeat (STR) testing is performed at the Cytogenetics and Cell Authentication core facility at MDACC. STR testing is performed on tissue from the initial tumor grown in the mouse (transplant generation 1 - TG1) and from a patient sample when possible. Thereafter, STR testing is performed every five transplant generations (TG5, TG10, TG15, and TG20). In the case that a PDX model is transplanted from viably frozen tissue to restart the model, the PDX Core will test the first outgrowth to confirm identity and every five transplant generations thereafter. In addition to STR, we assess clinical biomarkers and histology every 5th transplant generation. Finally, RNAseq gene expression profiles are evaluated periodically to ensure consistency with previous results and to evaluate phenotypic drift. If a significant change in PDX biology is noted, we identify the last known stable stock and re-start the model.

Histology Information for Model: BCM-0002

Patient

PDX

HER2

Metastasis Information for Model: BCM-0002

Patient

PDX

Abdomen

Adrenal gland

Bone

Bones

Brain

CTC

Chest

Chest wall

Contralateral Breast

Dura

Fallopian Tubes

Head

Kidney

Liver

Lung

Lymph node

Lymph nodes

Neck

Ovary

Pancreas

Pericardium

Peritoneal cavity

Peritoneum

Pleura

Pleural effusion

Shoulder

Skin

Spine

Spleen

Thoracic Spine

Thymus

Patient Treatment Information for Model: BCM-0002

Event Id	Treatment	Treatment Setting	Age at Start	Age at End	Duration	Clinical Response	Pathologic Response	Reason Stopped
10	Docetaxel,Doxorubicin	Neoadjuvant	43.62	44.12	183 days	Partial Response	Partial Response	Treatment Completed
15	Radiation Therapy	Adjuvant	43.7	43.87	62 days	Not Reported	Not Applicable	Treatment Completed
20	Docetaxel,Doxorubicin	Adjuvant	43.95	44.12	62 days	Not Reported	Not Applicable	Unknown
25	Docetaxel	Adjuvant	44.2	44.62	153 days	Not Reported	Not Applicable	Unknown
30	Tamoxifen	Adjuvant	45.62	50.45	1763 days	Not Reported	Not Applicable	Treatment Completed
35	Letrozole	Adjuvant	50.48	52.7	810 days	Not Reported	Not Applicable	Disease Progression
50	Carboplatin,Paclitaxel	Metastatic	52.77	54.13	496 days	Not Reported	Not Applicable	Unknown
55	Carboplatin	Metastatic	54.18	54.97	288 days	Not Reported	Not Applicable	Unknown
60	Anastrozole	Metastatic	55.62	56.08	168 days	Disease Progression	Not Applicable	Disease Progression
70	Radiation Therapy	Metastatic	56.0	56.1	37 days	Not Reported	Not Applicable	Treatment Completed
75	Capecitabine	Metastatic	56.08	57.0	336 days	Disease Progression	Not Applicable	Disease Progression
80	Gemcitabine	Metastatic	57.0	57.91	332 days	Disease Progression	Not Applicable	Disease Progression
90	Radiation Therapy	Metastatic	57.11	57.11	1	Not Reported	Not Applicable	Treatment Completed